View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2659_low_16 (Length: 269)
Name: NF2659_low_16
Description: NF2659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2659_low_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 20 - 260
Target Start/End: Complemental strand, 44910751 - 44910517
Alignment:
| Q |
20 |
ctataatggtcccaactgtttctgagctttttggtttgaagcactttggtgtaataagtagcttcatgatgctaggaaatccaattggtgcccttctttt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44910751 |
ctataatggtcccaactgtttctgagctttttggtttgaagcactttggtgtaataagtagcttcatgatgctaggaaatccaattggtgcccttctttt |
44910652 |
T |
|
| Q |
120 |
ttctgttttccttgctggaaatttgtatgatactgaagcggcgaagcaaggaaactccacctgctacggtgcaaattgtttcagaatcacttttcttgtt |
219 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44910651 |
ttctgtt------gctggaaatttgtatgatactgaagcggcgaagcaaggaaactccacctgctacggtgcaaattgtttcagaatcacttttcttgtt |
44910558 |
T |
|
| Q |
220 |
ttggctggtgtatgtggaattggtaccattttgagtataat |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44910557 |
ttggctggtgtatgtggaattggtaccattttgagtataat |
44910517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 115 - 152
Target Start/End: Complemental strand, 44909689 - 44909652
Alignment:
| Q |
115 |
cttttttctgttttccttgctggaaatttgtatgatac |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44909689 |
cttttttctgttttccttgctggaaatttgtatgatac |
44909652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University