View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2659_low_21 (Length: 237)
Name: NF2659_low_21
Description: NF2659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2659_low_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 65 - 220
Target Start/End: Original strand, 9609672 - 9609828
Alignment:
| Q |
65 |
caaatatttggaaaacctaacatagaatagaacacagggttttgagtggcttgattttcttttaaccattgtacatatgatttttaattcctcagtgcca |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9609672 |
caaatatttggaaaacctaacatagaatagaacacggggttttgagtggcttgattttcttttaaccattgtacatatgatttttaattcctcagtgcca |
9609771 |
T |
|
| Q |
165 |
-nnnnnnnatatttttacacgtttcgaacatttggaatgactatacttccttttctc |
220 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
9609772 |
tttttttaatatttttacacgtttcgaacatttggattgactatacttccttttctc |
9609828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University