View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2659_low_7 (Length: 422)
Name: NF2659_low_7
Description: NF2659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2659_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 379; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 379; E-Value: 0
Query Start/End: Original strand, 14 - 404
Target Start/End: Original strand, 43598619 - 43599009
Alignment:
| Q |
14 |
tactatacttaccgttaatttaagcatgcacgtccatttcttacagtttctaaatatatgcaacaaattaatcaatgattttatgtttgtaattttatca |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43598619 |
tactatacttaccgttaatttaagcatgcacgtccatttcttacagtttcttaatatatgcaacaaattaatcaatgattttatgtttgtaattttatca |
43598718 |
T |
|
| Q |
114 |
ggtgattgccacatttactgcaattggaatcatctttatccctattggtcttgcatcattgttttcatcagggaaggtaatgaacataacaatgtataga |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43598719 |
ggtgattgccacatttactgcaattggaataatctttatccctattggtcttgcatcattgttttcatcagggaaggtaatgaacataacaatgtataga |
43598818 |
T |
|
| Q |
214 |
atgaaattaagttttggtagtgaattttatttataatgataaagaaatactaatgcaggtggtggaagctgaattcagatatgatgaaacgtgtctttct |
313 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43598819 |
atgaaattaagttttggtactgaattttatttataatgataaagaaatactaatgcaggtggtggaagctgaattcagatatgatgaaacgtgtctttct |
43598918 |
T |
|
| Q |
314 |
ccggatgttgctaaagatgcagttgcatatattaaaagtgataccactaacaagacttgcacccacaaatggattgttagtacattcactt |
404 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43598919 |
ccggatgttgctaaagatgcagttgcatatattaaaagtgataccactaacaagacttgcacccacaaatggattgttagtacattcactt |
43599009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University