View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2660_high_30 (Length: 259)

Name: NF2660_high_30
Description: NF2660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2660_high_30
NF2660_high_30
[»] chr5 (3 HSPs)
chr5 (11-94)||(32580977-32581060)
chr5 (18-95)||(32573598-32573675)
chr5 (175-222)||(32580885-32580932)


Alignment Details
Target: chr5 (Bit Score: 76; Significance: 3e-35; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 11 - 94
Target Start/End: Complemental strand, 32581060 - 32580977
Alignment:
11 aagcaaaggctgaaattattaattttgtttatgtcacgattctatttctttccttgtttcgtgtcgcaacagcatccggtgaac 94  Q
    |||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32581060 aagcaatgactgaaattattaattttgtttatgtcacgattctatttctttccttgtttcgtgtcgcaacagcatccggtgaac 32580977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 18 - 95
Target Start/End: Complemental strand, 32573675 - 32573598
Alignment:
18 ggctgaaattattaattttgtttatgtcacgattctatttctttccttgtttcgtgtcgcaacagcatccggtgaact 95  Q
    |||||||||||| ||||||||||||||||||||||||||||||| ||| |||| ||||||||||  ||||||| ||||    
32573675 ggctgaaattatcaattttgtttatgtcacgattctatttcttttcttctttcatgtcgcaacaatatccggtaaact 32573598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 32580932 - 32580885
Alignment:
175 gatcgttcatgatcttttatcatgttttaataacattgttttgttatc 222  Q
    |||||| ||||||||||||||||||||||||||| |||||||||||||    
32580932 gatcgtacatgatcttttatcatgttttaataacgttgttttgttatc 32580885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University