View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2660_high_37 (Length: 238)
Name: NF2660_high_37
Description: NF2660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2660_high_37 |
 | |
|
| [»] scaffold0007 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0007 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 22 - 219
Target Start/End: Original strand, 153840 - 154037
Alignment:
| Q |
22 |
agcgtggattacatggtgtgaaagtagatgtatggagtgttgggtatttgataatgacatgtgggttggtgaatgtgccaaagatgttaagagagttaca |
121 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
153840 |
agcgtggattgcatggtgtgaaagttgatgtgtggagtgttgggtatttgataatgacatgtgggttggtgaatgtgccaaagatgttaagagagttaca |
153939 |
T |
|
| Q |
122 |
gaattggtgtatggaacagaatccagaacaaagaccaactgcagcggattgttatcatcacttgttacaacttcagtcgactttgttggtgtcaggtg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
153940 |
gaattggtgtatggaacagaatccagaacaaagaccaactgcagcggattgttatcatcacttgttacaacttcagtcgactttgttggtgtcaggtg |
154037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University