View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2660_high_40 (Length: 234)
Name: NF2660_high_40
Description: NF2660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2660_high_40 |
 |  |
|
| [»] scaffold0152 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 15 - 201
Target Start/End: Complemental strand, 31379050 - 31378864
Alignment:
| Q |
15 |
ttgtttctttttcagggatcaatacacattgaaggaatgtgagttacaagtactcaatagttgttcaataagtcaggtcgaagctggatcacaaggagtc |
114 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31379050 |
ttgtttctttttcaggtatcaatacacattgaaggaatgtgaggtacaagtactcaatagttgttcaataagtcaggtcgaagctggatcacaaggagtc |
31378951 |
T |
 |
| Q |
115 |
tagagtttggattttcatactgtatctttcacttttaaactattttctaaatatttgtcaagtttcatgtaaagtgtatagaagatt |
201 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
31378950 |
tagagtttggattttcatattgtatctttcacttttcaactattttctaaatatttgtcaagtttcatgtaaagtttatagacgatt |
31378864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0152 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0152
Description:
Target: scaffold0152; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 205 - 234
Target Start/End: Original strand, 13457 - 13486
Alignment:
| Q |
205 |
aaaagttgtcataccccaatttttgaccta |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
13457 |
aaaagttgtcataccccaatttttgaccta |
13486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University