View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2660_low_20 (Length: 342)
Name: NF2660_low_20
Description: NF2660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2660_low_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 32 - 331
Target Start/End: Original strand, 43987082 - 43987382
Alignment:
| Q |
32 |
actatagttgttttgttttgagttgagttgaatttggatagtgtaaggtaaggttatattataggaggaagagaaggacatgagcgtgtgttgttgctga |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
43987082 |
actatagttgttttgttttgagttgagttgaacttggatagtgtaaggtaaggttatattatagga---agagaaggacatgagcgtgtgttgttgctga |
43987178 |
T |
 |
| Q |
132 |
ctgtggaatatagtggacacgtgttaagatatttggttgactaggatttagaggaaatgagtaggaactggggaagattcgttatggacacgtggaggat |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43987179 |
ctgtggaatatagtggacacgtgttaagatatttggttgactaggatttagaggaaatgagtaggaactggggaagattcgttatggacacgtggaggat |
43987278 |
T |
 |
| Q |
232 |
tacggttgctgtaactaaatttatttatctgtttttgtggatttgtaaatgtaattggg----ggaaggaaggaggagtgaggaaaagatttgaaatgat |
327 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43987279 |
tacggttgctgtaactaaatttatttatctgtttttgtggatttgtaaatgtaattgggggaaggaaggaaggaggagtgaggaaaagatttgaaatgat |
43987378 |
T |
 |
| Q |
328 |
gatg |
331 |
Q |
| |
|
|||| |
|
|
| T |
43987379 |
gatg |
43987382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University