View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2660_low_23 (Length: 329)
Name: NF2660_low_23
Description: NF2660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2660_low_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 54; Significance: 5e-22; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 70 - 127
Target Start/End: Original strand, 4125060 - 4125117
Alignment:
| Q |
70 |
gtgaaaaccaatgagatgcagtctattttatggaaaatcgagttcgaactgtttcttg |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4125060 |
gtgaaaaccaatgagatgcagtctattttatggaaaatcgaggtcgaactgtttcttg |
4125117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 257 - 314
Target Start/End: Original strand, 4125247 - 4125304
Alignment:
| Q |
257 |
ctcatattttcattgtgtttttattctctatttatcgtattggattttatggtaatac |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| ||||||| |||||| |
|
|
| T |
4125247 |
ctcatattttcattgtgtttttattctctatttatcgcattgatttttatgataatac |
4125304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University