View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2660_low_25 (Length: 305)
Name: NF2660_low_25
Description: NF2660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2660_low_25 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 24 - 287
Target Start/End: Original strand, 34388032 - 34388295
Alignment:
| Q |
24 |
gaatcatgataatcgggttaaacggagaaatgtctccaccgttaacattgtttctacggcggcgtcgaaaagtattttgattataattgttattgcgatg |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
34388032 |
gaatcatgataatcgggttaaacggagaaatgtctccaccgttaacattgtttctacggtggcgtcgaaaagtattttgattataattattattgcgatg |
34388131 |
T |
|
| Q |
124 |
gcctatcatgtacatagccgccgccatagggaacctcattcgacggccaccaacagtattggcggaatgtgttgattgttcgacatcttccagaaagccg |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34388132 |
gcctatcatgtacatagccgccgccatagggaacctcattcgacggccaccaacagtattggcggaatgtgttgattgttcgacatcttccagaaagccg |
34388231 |
T |
|
| Q |
224 |
ctgtcacaatcgggacatattggcatccctagcctccataccctaacaaatttgttgcacctat |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34388232 |
ctgtcacaatcgggacatattggcatccctagcctccataccctaacaaatttgttgcacctat |
34388295 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University