View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2660_low_30 (Length: 302)
Name: NF2660_low_30
Description: NF2660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2660_low_30 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 28 - 260
Target Start/End: Original strand, 28672544 - 28672769
Alignment:
| Q |
28 |
gcagagaagaaaatgtcatcaagacactaggacagttaccaccatataccaataatccttctcggccggctctgcgagcaacggtaaatgagcatcaccc |
127 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||| ||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
28672544 |
gcagagaagaaaatgtcatcaagacacta-------tactaccatataccaataatccttctcagccggctctgcgagcaatggtaaatgagcaccaccc |
28672636 |
T |
 |
| Q |
128 |
gtgcggcccaggatgcccaccagattcgaccttgtaatccaacctcgcccatgatagtgtctaatgcataaacctttacggaaaattgaccagcacccat |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28672637 |
gtgcggcccaggatgcccaccagattcgaccctgtaatccaacctcgcccatgatagtgtctaatgcataaacctttacggaaaattgaccagcacccat |
28672736 |
T |
 |
| Q |
228 |
gagaccgagaccatggttgtcaattatggaaga |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
28672737 |
gagaccgagaccatggttgtcaattatggaaga |
28672769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 266 - 302
Target Start/End: Original strand, 28672824 - 28672860
Alignment:
| Q |
266 |
gttgcaagctaaaatccaagattgtgaataaacaaac |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28672824 |
gttgcaagctaaaatccaagattgtgaataaacaaac |
28672860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 28676136 - 28676185
Alignment:
| Q |
1 |
ttattcaccaactaactttgagcaatagcagagaagaaaatgtcatcaag |
50 |
Q |
| |
|
||||||||||||||| ||||||||| |||| ||||||||| |||||||| |
|
|
| T |
28676136 |
ttattcaccaactaattttgagcaagagcaaggaagaaaatatcatcaag |
28676185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University