View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2660_low_36 (Length: 259)
Name: NF2660_low_36
Description: NF2660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2660_low_36 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 76; Significance: 3e-35; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 11 - 94
Target Start/End: Complemental strand, 32581060 - 32580977
Alignment:
| Q |
11 |
aagcaaaggctgaaattattaattttgtttatgtcacgattctatttctttccttgtttcgtgtcgcaacagcatccggtgaac |
94 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32581060 |
aagcaatgactgaaattattaattttgtttatgtcacgattctatttctttccttgtttcgtgtcgcaacagcatccggtgaac |
32580977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 18 - 95
Target Start/End: Complemental strand, 32573675 - 32573598
Alignment:
| Q |
18 |
ggctgaaattattaattttgtttatgtcacgattctatttctttccttgtttcgtgtcgcaacagcatccggtgaact |
95 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||| ||| |||| |||||||||| ||||||| |||| |
|
|
| T |
32573675 |
ggctgaaattatcaattttgtttatgtcacgattctatttcttttcttctttcatgtcgcaacaatatccggtaaact |
32573598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 32580932 - 32580885
Alignment:
| Q |
175 |
gatcgttcatgatcttttatcatgttttaataacattgttttgttatc |
222 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32580932 |
gatcgtacatgatcttttatcatgttttaataacgttgttttgttatc |
32580885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University