View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2660_low_38 (Length: 252)
Name: NF2660_low_38
Description: NF2660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2660_low_38 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 21 - 252
Target Start/End: Original strand, 34387491 - 34387722
Alignment:
| Q |
21 |
gaaaatcttccaacggcaaaccctccacccggtaacctccaaattgtcaacccaacattctcgtcttcattcgaattggaaatttcattgttaatttgtg |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34387491 |
gaaaatcttccaacggcaaaccctccacccggtaacctccaaattgtcaacccaacattctcgtcttcattcgaattggaaatttcattgttaatttgtg |
34387590 |
T |
 |
| Q |
121 |
gtgattcacaaggcaattcatgtcgacaaacgggacaagaattttgaattgcaagccatggaagtatgcattcattatggtatatgtgtttgcatggcat |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34387591 |
gtgattcacaaggcaattcatgtcgacaaacgggacaagaattttgaattgcaagccatggaagtatgcattcattatggtatatgtgtttgcatggcat |
34387690 |
T |
 |
| Q |
221 |
ttcactagctgaaattccaagttcaaaaggct |
252 |
Q |
| |
|
||| |||||||||||||||||||||||||||| |
|
|
| T |
34387691 |
ttccctagctgaaattccaagttcaaaaggct |
34387722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 76
Target Start/End: Original strand, 41697403 - 41697456
Alignment:
| Q |
23 |
aaatcttccaacggcaaaccctccacccggtaacctccaaattgtcaacccaac |
76 |
Q |
| |
|
|||||||||||| ||||| || || |||||||||||||| |||||||| ||||| |
|
|
| T |
41697403 |
aaatcttccaacagcaaatccacctcccggtaacctccatattgtcaatccaac |
41697456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University