View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2660_low_46 (Length: 238)
Name: NF2660_low_46
Description: NF2660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2660_low_46 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 27 - 238
Target Start/End: Complemental strand, 7609808 - 7609602
Alignment:
| Q |
27 |
gagttctcaaaaccttatcaacatggaattttgaggttatttattctgttannnnnnnnnctttccatctcatacgctgcttatatacttacttttcctc |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7609808 |
gagttctcaaaaccttatcaacatggaattttgaggtgatttattctgttcttgtt-----tttccatctcatacgctgcttctatacttacttttcctc |
7609714 |
T |
 |
| Q |
127 |
ttcatgaccgcaaccatgtagattctcgtgtttggaagcacacagtgtaccatcactacatgtcccagcaacaagtcctacccaaagctcgttcctttat |
226 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||||| |||||||||||||| |||||||||||| ||||||| |||||||||||| |
|
|
| T |
7609713 |
ttcatgaccgcaaccctgtagattctcgtgtttggaagcaaacagtgtaccgtcactacatgtcccggcaacaagtcctgcccaaagttcgttcctttat |
7609614 |
T |
 |
| Q |
227 |
gtggcgtgtggc |
238 |
Q |
| |
|
|||||||||||| |
|
|
| T |
7609613 |
gtggcgtgtggc |
7609602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University