View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2660_low_50 (Length: 210)
Name: NF2660_low_50
Description: NF2660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2660_low_50 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 129; Significance: 6e-67; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 54 - 194
Target Start/End: Original strand, 43577984 - 43578124
Alignment:
| Q |
54 |
aaagtttttgcgttttcgttaaaaaacattcattttagtcgataacagtaggttatatataccatccttctattttctcttggatcaaatgcaatattga |
153 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43577984 |
aaagtttttgcgttttctttaaaaaacattcattttagtcggtaacagtaggttatatataccatccttctattttctcttggatcaaatgcaatattga |
43578083 |
T |
|
| Q |
154 |
caacacaacaaaaggttgtcttagatcagatgctagtgttg |
194 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43578084 |
caacacaacaaaagattgtcttagatcagatgctagtgttg |
43578124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 16 - 56
Target Start/End: Original strand, 43577824 - 43577864
Alignment:
| Q |
16 |
tatactgtacaaattacaaagggcctactgcgagactcaaa |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43577824 |
tatactgtacaaattacaaagggcctactgcgagactcaaa |
43577864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University