View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2660_low_51 (Length: 204)

Name: NF2660_low_51
Description: NF2660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2660_low_51
NF2660_low_51
[»] chr7 (1 HSPs)
chr7 (1-184)||(11665096-11665279)


Alignment Details
Target: chr7 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 184
Target Start/End: Complemental strand, 11665279 - 11665096
Alignment:
1 atctattatcaatgatattataagagagaggcgtaaagttaatattgctggacctgtggaaggaggggacctcttgaatttgattttatcaaagcagaat 100  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11665279 atctattatcaatgatattataatagagaggcgtaaagttaatattgctggacctgtggaaggaggggacctcttgaatttgattttatcaaagcagaat 11665180  T
101 ttaagtgatgaagagatggtgagcattgttacggaccttttgtttgggggatatgagacaacctcaaaacttctgtctttgatt 184  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||    
11665179 ttaagtgatgaagagatggtgagcattgttatggaccttttgtttgggggatatgagacaacctcaaaacttctgtctctgatt 11665096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University