View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2662_high_37 (Length: 325)
Name: NF2662_high_37
Description: NF2662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2662_high_37 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 155; Significance: 3e-82; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 19 - 252
Target Start/End: Complemental strand, 25584434 - 25584206
Alignment:
| Q |
19 |
ccaaccacttcacacagttcactttcttgctgctgccggagctttttctaatcacctttagcaacactttcctccttcaaccttcttttaaggtacacaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
25584434 |
ccaaccacttcacacagttcactttcttgctgctgccggagctttttctaatcacctttagcaacactttcctccttcaaccttcttttaaggtacataa |
25584335 |
T |
|
| Q |
119 |
caaattattatannnnnnnctatacatcaaataattatgttagttttcagagtttgaacttgtaatcttttttacttaaaacttcttcaacgtctcttat |
218 |
Q |
| |
|
|||||||||||| ||||| ||||||| ||||||||||||||||||||||||||| |||||||||| | ||||||||||||| |||||||| |
|
|
| T |
25584334 |
caaattattata-ttttttctatatatcaaattattatgttagttttcagagtttgaactcgtaatctttt----taaaaacttcttcaatgtctcttac |
25584240 |
T |
|
| Q |
219 |
ctcaccaaccgaattgcatgatcatgaaaaatac |
252 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||| |
|
|
| T |
25584239 |
ctcaccaaccgaactgcatgattatgaaaaatac |
25584206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 266 - 300
Target Start/End: Complemental strand, 25584147 - 25584113
Alignment:
| Q |
266 |
gtttgacctctgaacctcttactcaaaactttttt |
300 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25584147 |
gtttgacctctaaacctcttactcaaaactttttt |
25584113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University