View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2662_high_38 (Length: 325)
Name: NF2662_high_38
Description: NF2662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2662_high_38 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 160; Significance: 3e-85; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 18 - 196
Target Start/End: Complemental strand, 15588980 - 15588801
Alignment:
| Q |
18 |
agtaccatcttcaacaaagttcacaaaagctttatgtggatgaatgagtttttgcactagcaaaaa-atctatgttatttcccatctgctagaatattat |
116 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
15588980 |
agtaccagcttcaacaaagtacacaaaagctttatgtggatgaatgagtttttgcactagcaaaaagatctatgttatttcccatctgcaagaatattat |
15588881 |
T |
 |
| Q |
117 |
atgagtgtcaattatcatttaattattgtggtggtatcaaataaatggattttatatttacttttcttttcccttgccat |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15588880 |
atgagtgtcaattatcatttaattattgtggtggtatcaaataaatggattttatatttacttttcttttcccttgccat |
15588801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 122 - 224
Target Start/End: Complemental strand, 15600880 - 15600778
Alignment:
| Q |
122 |
tgtcaattatcatttaattattgtggtggtatcaaataaatggattttatatttacttttcttttcccttgccattatggcttttgtactctaagacaat |
221 |
Q |
| |
|
|||| ||| ||||||| |||||| |||| ||||||||||||||||||||| ||||||||||||||| |||| |||||||||||||||||||||| ||| |
|
|
| T |
15600880 |
tgtctattgtcatttagttattgcggtgatatcaaataaatggattttatgtttacttttcttttcacttgttgttatggcttttgtactctaagaaaat |
15600781 |
T |
 |
| Q |
222 |
aat |
224 |
Q |
| |
|
||| |
|
|
| T |
15600780 |
aat |
15600778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 131 - 211
Target Start/End: Complemental strand, 15610512 - 15610433
Alignment:
| Q |
131 |
tcatttaattattgtggtggtatcaaataaatggattttatatttacttttcttttcccttgccattatggcttttgtact |
211 |
Q |
| |
|
||||||| |||||| |||| |||||||||||||||||| ||||||||||||||||||| || || |||||||||||||||| |
|
|
| T |
15610512 |
tcatttagttattgcggtgatatcaaataaatggattt-atatttacttttcttttccgttacctttatggcttttgtact |
15610433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 241 - 323
Target Start/End: Complemental strand, 15588786 - 15588705
Alignment:
| Q |
241 |
taacgagtgtctctaggcactttttaagaatcattaacagtaagtttttatnnnnnnnctatgtaatcaatgcattgaaattt |
323 |
Q |
| |
|
||||||||| | || | |||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
15588786 |
taacgagtgcccctggacactctttaagaatcattaacagtaagtttttatgaaaaat-tatgtaatcaatgcattgaaattt |
15588705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 47 - 83
Target Start/End: Complemental strand, 15610568 - 15610532
Alignment:
| Q |
47 |
ctttatgtggatgaatgagtttttgcactagcaaaaa |
83 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
15610568 |
ctttatatggatgaataagtttttgcactagcaaaaa |
15610532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University