View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2662_high_42 (Length: 305)
Name: NF2662_high_42
Description: NF2662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2662_high_42 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 6 - 287
Target Start/End: Original strand, 47358677 - 47358955
Alignment:
| Q |
6 |
cagagatggcctaaaaggacagtgatgatgaaccacatgcatgcatgtttatgtttatctataatagcaaaactttagggtactcatcatgtaataatgt |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
47358677 |
cagagatggcctaaaaggacagtgatgatgaaccacatgcatgcatgtttatgtttatctataatagcaaaactttagggtactcatcatgtaat---gt |
47358773 |
T |
 |
| Q |
106 |
aatggtgctgtatcatcatcaaccacaatcacaaaggcatgcattaaaaacaatgtctacttcttcccctgccgtgcacgctgtacgtacgtcttaattg |
205 |
Q |
| |
|
||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47358774 |
aatagtgctgcatcatcatcaaccacaatcacaaaggcatgcattaaaaacaatgtctacttcttcccctgccgtgcacgctgtacgtacgtcttaattg |
47358873 |
T |
 |
| Q |
206 |
tttttatttctccagtctaaaaagcaaactcaccattttaagtttggttcatgcttaattgtctgtgcccaattgtcaatgc |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47358874 |
tttttatttctccagtctaaaaagcaaactcaccattttaagtttggttcatgcttaattgtctgtgcccaattgtcaatgc |
47358955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University