View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2662_high_49 (Length: 275)
Name: NF2662_high_49
Description: NF2662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2662_high_49 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 19 - 265
Target Start/End: Complemental strand, 505597 - 505351
Alignment:
| Q |
19 |
cttggaacataccctacagctgaaatggcagctagagcacatgatgtagctgctttagctataaagggtcattcagcataccttaatttccctgaattgg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
505597 |
cttggaacataccctacagctgaaatggcagctagagcacatgatgtagctgctttagctataaagggtcattcagcataccttaatttccctgaattgg |
505498 |
T |
|
| Q |
119 |
tacaacaacttccaaagccaataagtacttctacaaaagacattcaagctgctgctgcaaaagctgcaaacactgtatttgtagctgaaccaagacaaga |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
505497 |
tacaacaacttccaaagccaataagtacttctacaaaagacattcaagctgctgctgcaaaagctgcaaacactgtatttgtagctgaaccaatacaaga |
505398 |
T |
|
| Q |
219 |
agaacatttctcatcttcaacttcaacatttaccactaatgatgatg |
265 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
505397 |
agaacatttctcatcttcaagttcaacatttaccaataatgatgatg |
505351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 77; Significance: 8e-36; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 16357872 - 16357780
Alignment:
| Q |
19 |
cttggaacataccctacagctgaaatggcagctagagcacatgatgtagctgctttagctataaagggtcattcagcataccttaatttccct |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| ||||| ||||||||| |
|
|
| T |
16357872 |
cttggaacataccctacagctgaaatggcagctagagctcatgatgtagctgctttagccataaagggtcattcagcttacctcaatttccct |
16357780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 19 - 96
Target Start/End: Complemental strand, 43561862 - 43561785
Alignment:
| Q |
19 |
cttggaacataccctacagctgaaatggcagctagagcacatgatgtagctgctttagctataaagggtcattcagca |
96 |
Q |
| |
|
|||||||| ||| |||| ||||||||||||||||||| |||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
43561862 |
cttggaacttacgctactcctgaaatggcagctagagcgcatgatgttgctgctttgagtataaagggtcattcagca |
43561785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 22 - 70
Target Start/End: Complemental strand, 36077792 - 36077744
Alignment:
| Q |
22 |
ggaacataccctacagctgaaatggcagctagagcacatgatgtagctg |
70 |
Q |
| |
|
||||| ||||||||| | ||||||||||||| ||||||||||||||||| |
|
|
| T |
36077792 |
ggaacttaccctacaccagaaatggcagctatagcacatgatgtagctg |
36077744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University