View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2662_high_53 (Length: 254)
Name: NF2662_high_53
Description: NF2662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2662_high_53 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 86; Significance: 3e-41; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 101 - 210
Target Start/End: Complemental strand, 28402734 - 28402625
Alignment:
| Q |
101 |
tagtatctcccaatgatattttatctcaattcttaataaattcaaatctaaatatatctagacataatattttgatccctcccagttctttttggccagc |
200 |
Q |
| |
|
||||||||||||||||||||||||||| |||| ||||||||| ||||||||||||| |||||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
28402734 |
tagtatctcccaatgatattttatctcgattcataataaattaaaatctaaatatacctagacataatattttgaaccctcccagttctttatggccagc |
28402635 |
T |
 |
| Q |
201 |
ttcaatacct |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
28402634 |
ttcaatacct |
28402625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 103 - 233
Target Start/End: Original strand, 19133611 - 19133738
Alignment:
| Q |
103 |
gtatctcccaatgatattttatctcaattcttaataaattcaaatctaaatatatctagacataatattttgatccctcccagttctttttggccagctt |
202 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| || ||||| |||||||||||||||||||||||||||||| |||||| ||||| ||||||||||| |
|
|
| T |
19133611 |
gtatatcccaatgatattttatctcaattcttagtagattcatatctaaatatatctagacataatattttgaaccctcctagttc---ttggccagctt |
19133707 |
T |
 |
| Q |
203 |
caatacctagctagagttcaaggtattaacc |
233 |
Q |
| |
|
||| |||||||||| |||||||||||||||| |
|
|
| T |
19133708 |
caacacctagctagggttcaaggtattaacc |
19133738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 159 - 210
Target Start/End: Complemental strand, 19931635 - 19931584
Alignment:
| Q |
159 |
tagacataatattttgatccctcccagttctttttggccagcttcaatacct |
210 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
19931635 |
tagacataatattttgaaccctcccagttctttttggccagcttcaatacct |
19931584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University