View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2662_high_55 (Length: 250)

Name: NF2662_high_55
Description: NF2662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2662_high_55
NF2662_high_55
[»] chr7 (2 HSPs)
chr7 (1-237)||(44948976-44949214)
chr7 (12-108)||(6469968-6470064)
[»] scaffold0003 (1 HSPs)
scaffold0003 (12-119)||(419620-419727)


Alignment Details
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 44949214 - 44948976
Alignment:
1 ctactttacttcctttccatgtttttcttgtgagcgaatgagcttttgttcacccgatggcgttgtctctacaggagcatgtgtctattatcagaaatgg 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
44949214 ctactttacttcctttccatgtttttcttgtgagcgaatgagcttttgttcacccgatggcgttgtctctccaggagcatgtgtctattatcagaaatgg 44949115  T
101 ttggatttctgagtgagttgattactactgaatga-nnnnnnnnnnnnnnnataaacgactct-ccaagttttgactcacataacagctattgtggtttc 198  Q
    |||||||||||| ||||||||||||||||||||||                |||||||||||| ||||||||||||||||||||||||||||||||||||    
44949114 ttggatttctgaatgagttgattactactgaatgatttttaatttttttttataaacgactctcccaagttttgactcacataacagctattgtggtttc 44949015  T
199 ttttttcactctctttttaacttaattgctaatgtatct 237  Q
    |||||||||||||||||||||||||||||||||||||||    
44949014 ttttttcactctctttttaacttaattgctaatgtatct 44948976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 12 - 108
Target Start/End: Complemental strand, 6470064 - 6469968
Alignment:
12 cctttccatgtttttcttgtgagcgaatgagcttttgttcacccgatggcgttgtctctacaggagcatgtgtctattatcagaaatggttggattt 108  Q
    |||||||||||||||||||| | || ||||||||||||||| | ||||| ||||||||| ||  | ||||||| |||| ||||||||||||||||||    
6470064 cctttccatgtttttcttgtcaacggatgagcttttgttcatcggatggtgttgtctctccaacaacatgtgtgtattttcagaaatggttggattt 6469968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: scaffold0003
Description:

Target: scaffold0003; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 12 - 119
Target Start/End: Original strand, 419620 - 419727
Alignment:
12 cctttccatgtttttcttgtgagcgaatgagcttttgttcacccgatggcgttgtctctacaggagcatgtgtctattatcagaaatggttggatttctg 111  Q
    |||||||||||||||||||| | || ||||||||||||||| | || || ||||||||| ||  | ||||||||||||||||||||||||||||||| ||    
419620 cctttccatgtttttcttgtcaacggatgagcttttgttcaacagacggtgttgtctctccaacaacatgtgtctattatcagaaatggttggatttttg 419719  T
112 agtgagtt 119  Q
    | ||||||    
419720 aatgagtt 419727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University