View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2662_high_69 (Length: 227)
Name: NF2662_high_69
Description: NF2662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2662_high_69 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 16 - 215
Target Start/End: Complemental strand, 14727546 - 14727347
Alignment:
| Q |
16 |
aaaggaaagagattctatagagaaatacgggaaagagattttgtagagaggaatctgggaagaggaagcttttctgtattgttcttcgtgctggtggaaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14727546 |
aaaggaaagagattctatagagaaatacgggaaagagattttgtagagaggaatctgggaagaggaagcttttctgtattgttcttcgtgctggtggaaa |
14727447 |
T |
|
| Q |
116 |
gatattggaggggtagatatgatggcaagggagcactggtttcactagattttggttagatgtgtggacaggtttggttccgttcaccgagaagaagggt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14727446 |
gatattggaggggtagatatgatggcaagggagcactggtttcactagattttggttagatgtgtggacaggtttggttccgttcaccgagaagaagggt |
14727347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 18 - 208
Target Start/End: Original strand, 17595933 - 17596123
Alignment:
| Q |
18 |
aggaaagagattctatagagaaatacgggaaagagattttgtagagaggaatctgggaagaggaagcttttctgtattgttcttcgtgctggtggaaaga |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17595933 |
aggaaagagattctatagagaaatacgggaaagagattttgtagagaggaatctggggagaggaagcttttctgtattgttcttcgtgctggtggaaaga |
17596032 |
T |
|
| Q |
118 |
tattggaggggtagatatgatggcaagggagcactggtttcactagattttggttagatgtgtggacaggtttggttccgttcaccgagaa |
208 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||| | |||||| |
|
|
| T |
17596033 |
tattcgaggggtagatatgatggcaagggagcacttgtttcactagattttggttagatgtgtggacaggtttggttctgttaagcgagaa |
17596123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University