View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2662_high_70 (Length: 220)
Name: NF2662_high_70
Description: NF2662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2662_high_70 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 12 - 203
Target Start/End: Complemental strand, 10786963 - 10786771
Alignment:
| Q |
12 |
agcataggagaagggtttgacgagggatgttgggtttggccccatttttgttacctaa-gagatggtgtttgaaaattgtggtgttaatagcaatatgtc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||| | | | |||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
10786963 |
agcataggagaagggtttgacgagggatgttgggtttggcccaatttttgttacttcacgggatggtgtatgaaaatggtggtgttaatagcaatatgtc |
10786864 |
T |
 |
| Q |
111 |
caaattttcatttaagaaaattataactttcgtagttttaccttgtaatcttgtgtcatggtgattggtggtgtcgtgtaatgtgtatgcatt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10786863 |
aaaattttcatttaagaaaattataactttcatagttttaccttgcaatcttgtgtcatggtgattggtggtgtcgtgtaatgtgtatgcatt |
10786771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University