View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2662_high_75 (Length: 201)
Name: NF2662_high_75
Description: NF2662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2662_high_75 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 41 - 196
Target Start/End: Complemental strand, 45595431 - 45595276
Alignment:
| Q |
41 |
ttcttaccctggcaacatggcgcgagcggttgaaggccatcgtcgttttcttgggagaggaagaaccatttctccagataggtgagcctctctttctctc |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45595431 |
ttcttaccctggcaacatggcgcgagcggttgaaggccatcgtcgttttcttgggagaggaagaaccatttctccagataggtgagcctctctttctctc |
45595332 |
T |
|
| Q |
141 |
ctaagcagatgaattaattttgtaattcattatccctaatgtttgcctttgcttct |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45595331 |
ctaagcagatgaattaattttgtaattcattatccctaatgtttgcctttgcttct |
45595276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University