View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2662_low_11 (Length: 607)
Name: NF2662_low_11
Description: NF2662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2662_low_11 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 107; Significance: 2e-53; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 447 - 592
Target Start/End: Original strand, 9417024 - 9417172
Alignment:
| Q |
447 |
atactaataagaatagttcacaaggtccatagagtaaaattaatagtagagagaactaataacaattacatatgtagagataaataatacatatcttcaa |
546 |
Q |
| |
|
||||||||||||| ||||| ||||| || | ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
9417024 |
atactaataagaagagttcgtaaggtgcaaatagtaaaattaatagtagagagaactaataacaattgcatatgtagagataaataatacatatcttcaa |
9417123 |
T |
 |
| Q |
547 |
agttcaaacta---aataatacatcacataaataatattatggtataat |
592 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
9417124 |
agttcaaactaattaataatacatcacataaataatattatggtataat |
9417172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University