View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2662_low_30 (Length: 379)
Name: NF2662_low_30
Description: NF2662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2662_low_30 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 13 - 365
Target Start/End: Complemental strand, 30076339 - 30075988
Alignment:
| Q |
13 |
tgagagacatgataaactcatccacccgagactaagcctcttttgtgtcctatgttttatctcttgatttatgaagtcaatagtaatttgacccacacaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
30076339 |
tgagagacatgataaactcatccaccggagactaagcctcttttgtgtcctatgttttatctcttgatttatgaagtcaatagtaatttgagccacacaa |
30076240 |
T |
 |
| Q |
113 |
gtatgattccttgttgaagccattattcttattcctcttgatcctgtttaataggattttggttgtatttgttttcctctttgcctcagtttctttggga |
212 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
30076239 |
gtatgatt-cttgttgaagccattattcttattcctcttgatcctgtttaataggattttggttgtatttgttttcctctttggctcagtttctttggga |
30076141 |
T |
 |
| Q |
213 |
acaaggtacaacnnnnnnnnnnnnnnnnnnccccactcatagacccatttgtttgttgtgatttgcagactacttgttttcaatatcagttcattcttct |
312 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
30076140 |
acaaggtacaacttttttgttttactttttccccactcatggacccatttgtttgttgtgatttgcagaccacttgttttcaatatcagttgattcttct |
30076041 |
T |
 |
| Q |
313 |
gccgatgtgataaacgatctcatctgttattatgagattgaatggttcatatt |
365 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30076040 |
gccgatgtgataaacgatctcatctgttattatgagattgaatggttcatatt |
30075988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University