View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2662_low_36 (Length: 351)
Name: NF2662_low_36
Description: NF2662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2662_low_36 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 148; Significance: 5e-78; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 148; E-Value: 5e-78
Query Start/End: Original strand, 12 - 167
Target Start/End: Original strand, 9681243 - 9681398
Alignment:
| Q |
12 |
gcaaaggtacaaggattgtttggtgctaaatcgaaaaaatctcaattatattcatttaatttgtgcttaatttgcggcctcctctaattgcactctccct |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9681243 |
gcaaaggtacaaggattgtttggtgctaaatcgaaaaaatctcaattatattcatttaatttgtgcttaatttgcggcctcctctaattgcactctccct |
9681342 |
T |
 |
| Q |
112 |
ttcgttttaatgtgtgaccatacataaggcatgattatgcctcttcgaatgaaatg |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
9681343 |
ttcgttttaatgtgtgaccatacataaggcatgattatgcctcttggaatgcaatg |
9681398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 221 - 332
Target Start/End: Original strand, 9681452 - 9681563
Alignment:
| Q |
221 |
gagaactcaatgtcaacaaactgcaaaatcaacaagatttgatgatagaaccataaaataaatctgataataggaaaaagattgtcacgataaaaagaat |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9681452 |
gagaactcaatgtcaacaaactgcaaaatcaacaagatttgatgatagaaccataaaataaatctgataataggaaaaagattgtcacgataaaaagaat |
9681551 |
T |
 |
| Q |
321 |
ctataactatac |
332 |
Q |
| |
|
||||| |||||| |
|
|
| T |
9681552 |
ctatagctatac |
9681563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University