View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2662_low_42 (Length: 313)
Name: NF2662_low_42
Description: NF2662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2662_low_42 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 231; Significance: 1e-127; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 72 - 302
Target Start/End: Complemental strand, 25584033 - 25583803
Alignment:
| Q |
72 |
gttaggattctttttgtgttccttttatgttgtgcttattggtttgtgtcaaaacaggtaacatacttttgcagaaagaaaaaggggcaaaaacaatgag |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25584033 |
gttaggattctttttgtgttccttttatgttgtgcttattggtttgtgtcaaaacaggtaacatacttttgcagaaagaaaaaggggcaaaaacaatgag |
25583934 |
T |
|
| Q |
172 |
tcgaagaaatggaagtggtccaaaacttgacttgaaacttaacctatcaccaccaagggttgaccacagaagagttgagtcatcaccaacaagatcagca |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25583933 |
tcgaagaaatggaagtggtccaaaacttgacttgaaacttaacctatcaccaccaagggttgaccacagaagagttgagtcatcaccaacaagatcagca |
25583834 |
T |
|
| Q |
272 |
acagtgtcacctacatccccaccaagttcat |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
25583833 |
acagtgtcacctacatccccaccaagttcat |
25583803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 25584103 - 25584060
Alignment:
| Q |
1 |
ccaaccgaactacatgatcatgacaaaattagtgtcagtgatta |
44 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25584103 |
ccaaccgaactacatgatcatgacaaaattagtgtcagtgatta |
25584060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University