View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2662_low_49 (Length: 283)
Name: NF2662_low_49
Description: NF2662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2662_low_49 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 22 - 283
Target Start/End: Original strand, 7895422 - 7895683
Alignment:
| Q |
22 |
agaaataaggcagtgatggaagtgatctcatctttccaagttaagggctgcagttttagtaaatagatcaatgtaggatgatacaatcatacaatggtaa |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7895422 |
agaaataaggcagtgatggaagtgatctcatctttccaagttaagggctgcagttttagtaaatagatcaatgtaggatgatacaatcatacaatggtaa |
7895521 |
T |
 |
| Q |
122 |
ctgtgggatctatggtctttgtacaagttataattatctcatctttccatttctccctcttcctatcttcttataacagattaatgatcactcaacaaat |
221 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
7895522 |
ctgtgggacctatggtctttgtacaagttataattatctcatctttccatttctccctcttcctatcttcttataacagattaatgatcactcaacaact |
7895621 |
T |
 |
| Q |
222 |
tgcttcttaatctttgtaaaaagttaggattggggaacaaaatcgtcaaaacttcgtgttta |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7895622 |
tgcttcttaatctttgtaaaaagttaggattggggaacaaaatcgtcaaaacttcgtgttta |
7895683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University