View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2662_low_52 (Length: 271)

Name: NF2662_low_52
Description: NF2662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2662_low_52
NF2662_low_52
[»] chr3 (1 HSPs)
chr3 (30-252)||(21747391-21747613)


Alignment Details
Target: chr3 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 30 - 252
Target Start/End: Original strand, 21747391 - 21747613
Alignment:
30 atgtgaccctaattgtcatgtggacttttgttaaacaaatgtcattgtagttggaaaacgatgaccaaagttacaaatgaaaaatatgcaggcataaaat 129  Q
    ||||||| |||| |||  |||||||||| ||| ||||||||||  ||| ||||||||||||||| ||||||||||||   ||||||||||||||||||||    
21747391 atgtgacactaactgttgtgtggactttcgtttaacaaatgtcgatgttgttggaaaacgatgagcaaagttacaaacagaaaatatgcaggcataaaat 21747490  T
130 ttgtaagaatttttccggttgttggtaaacgattgaaggaaattctttatattaaaacaaaagttatgtatttacaatgactaaatatttaactaataaa 229  Q
    ||| |||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
21747491 ttgaaagaatttttccggttgttggtaaacaattgaaggaaattctttaaattaaaacaaaagttatgtatttacaatgactaaatatttaactaataaa 21747590  T
230 ctacaaatattctactaaaatct 252  Q
    |||||||||||||||||||||||    
21747591 ctacaaatattctactaaaatct 21747613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University