View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2662_low_56 (Length: 253)
Name: NF2662_low_56
Description: NF2662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2662_low_56 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 32336376 - 32336171
Alignment:
| Q |
1 |
tcatggattaatacattgattagtagtaatcaccattgttttgtcaaaagattcttgtgtgacagtgggactttccttttcaccgcatatacattaacta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32336376 |
tcatggattaatacattgattagtagtaatcaccattgttttgtcaaaagattcttgtgtgacagtgggactttccttttcaccgcatatacattaacta |
32336277 |
T |
|
| Q |
101 |
gttgacaagcatggtatttaattgcctcaaagnnnnnnngcatggtatttaatttggaccgttttttgtcaccacaatgtcaaaattgaaaataaattgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32336276 |
gttgacaagcatggtatttaattgcctcaaagaaaaaaagcatggtatttaatttggaccgttttttgtcaccacaatgtcaaaattgaaaataaattgt |
32336177 |
T |
|
| Q |
201 |
actgcc |
206 |
Q |
| |
|
|||||| |
|
|
| T |
32336176 |
actgcc |
32336171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University