View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2662_low_57 (Length: 250)
Name: NF2662_low_57
Description: NF2662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2662_low_57 |
 | |
|
| [»] scaffold0003 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 44949214 - 44948976
Alignment:
| Q |
1 |
ctactttacttcctttccatgtttttcttgtgagcgaatgagcttttgttcacccgatggcgttgtctctacaggagcatgtgtctattatcagaaatgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
44949214 |
ctactttacttcctttccatgtttttcttgtgagcgaatgagcttttgttcacccgatggcgttgtctctccaggagcatgtgtctattatcagaaatgg |
44949115 |
T |
|
| Q |
101 |
ttggatttctgagtgagttgattactactgaatga-nnnnnnnnnnnnnnnataaacgactct-ccaagttttgactcacataacagctattgtggtttc |
198 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
44949114 |
ttggatttctgaatgagttgattactactgaatgatttttaatttttttttataaacgactctcccaagttttgactcacataacagctattgtggtttc |
44949015 |
T |
|
| Q |
199 |
ttttttcactctctttttaacttaattgctaatgtatct |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44949014 |
ttttttcactctctttttaacttaattgctaatgtatct |
44948976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 12 - 108
Target Start/End: Complemental strand, 6470064 - 6469968
Alignment:
| Q |
12 |
cctttccatgtttttcttgtgagcgaatgagcttttgttcacccgatggcgttgtctctacaggagcatgtgtctattatcagaaatggttggattt |
108 |
Q |
| |
|
|||||||||||||||||||| | || ||||||||||||||| | ||||| ||||||||| || | ||||||| |||| |||||||||||||||||| |
|
|
| T |
6470064 |
cctttccatgtttttcttgtcaacggatgagcttttgttcatcggatggtgttgtctctccaacaacatgtgtgtattttcagaaatggttggattt |
6469968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 12 - 119
Target Start/End: Original strand, 419620 - 419727
Alignment:
| Q |
12 |
cctttccatgtttttcttgtgagcgaatgagcttttgttcacccgatggcgttgtctctacaggagcatgtgtctattatcagaaatggttggatttctg |
111 |
Q |
| |
|
|||||||||||||||||||| | || ||||||||||||||| | || || ||||||||| || | ||||||||||||||||||||||||||||||| || |
|
|
| T |
419620 |
cctttccatgtttttcttgtcaacggatgagcttttgttcaacagacggtgttgtctctccaacaacatgtgtctattatcagaaatggttggatttttg |
419719 |
T |
|
| Q |
112 |
agtgagtt |
119 |
Q |
| |
|
| |||||| |
|
|
| T |
419720 |
aatgagtt |
419727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University