View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2662_low_58 (Length: 250)
Name: NF2662_low_58
Description: NF2662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2662_low_58 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 10 - 250
Target Start/End: Original strand, 154381 - 154621
Alignment:
| Q |
10 |
ataatactgtagctgcatagtgaaattggatcaagttgttgtatttttcgattcgcagttgacaacactgattttggtgcatgcattttgactaataaca |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
154381 |
ataatactgtagctgcatagtgaaattggatcaagctgttgtatttttcgattcgcagttgacaacactgattttggtgcatgcattttgactaataaca |
154480 |
T |
 |
| Q |
110 |
acttaattgaattgcaggagaggtccaatattcaagattctactggtgatgattatctcgtttgtaacctcctgtattcgatttgggcttccattgctat |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
154481 |
acttaattgaattgcaggagaggtccaatattcaagattctgctggtgatgattatctcgtttgtaacctcctgtattcgatttgggcttccattgctat |
154580 |
T |
 |
| Q |
210 |
caaagtgtgtgccatgtccaggggagtgtcccagctcccca |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
154581 |
caaagtgtgtgccatgtccaggggagtgtcccagctcccca |
154621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University