View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2662_low_59 (Length: 250)
Name: NF2662_low_59
Description: NF2662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2662_low_59 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 30 - 250
Target Start/End: Complemental strand, 30077337 - 30077117
Alignment:
| Q |
30 |
agtaaaccattgaaggttaactccattgtgtttatttggataaattatttgccacagtcatgtaaatttggaaatctagatgtgtgacttggattctcaa |
129 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30077337 |
agtaaaccattgaaggttaactctattgtgtttatttggataaattatttgccacagtcatgtaaatttggaaatctagatgtgtgacttggattctcaa |
30077238 |
T |
 |
| Q |
130 |
tagcaaggagaattatgcattcacgtaatctagattaatgaaaatcgttaattatagtcatacgatgaagagtattttacttgtatgtatgttttaaaat |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30077237 |
tagcaaggagaattatgcattcacgtaatatagattaacgaaaatcgttaattatagtcatacgatgaagagtattttacttgtatgtatgttttaaaat |
30077138 |
T |
 |
| Q |
230 |
gtaactcaaactacaaaccat |
250 |
Q |
| |
|
||||||||||||| ||||||| |
|
|
| T |
30077137 |
gtaactcaaactataaaccat |
30077117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University