View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2662_low_61 (Length: 249)
Name: NF2662_low_61
Description: NF2662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2662_low_61 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 13 - 192
Target Start/End: Original strand, 9680073 - 9680253
Alignment:
| Q |
13 |
ttctctaataaaaacgacttaagtttgatgatatcatttctaattgtaccgttcttacttctttttatgtaaactctagtgttgagtttgcagaaaagta |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
9680073 |
ttctctaataaaaacgacttaagtttgatgatatcatttctaattgtaccattcttgcttcttttcatgtaaactctagtgttgagtttgcagaaaagta |
9680172 |
T |
 |
| Q |
113 |
aaggatatacta-actgcgacaaatcttatagggcaaagggattactaaaaaattgattgtgattatgattagaaaaacaa |
192 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9680173 |
aaggatatactagactgcgacaaatgttatagggcaaagggattactaaaaaattgattgtgattatgattagaaaaacaa |
9680253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 184 - 249
Target Start/End: Original strand, 9681125 - 9681190
Alignment:
| Q |
184 |
gaaaaacaattaataacacgtgtgtgttgaattgttgattattgaaatttaaatgtgatcactcaa |
249 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9681125 |
gaaaaacaattagtaacaggtgtgtgttgaattgttgattattgaaatttaaatgtgatcactcaa |
9681190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 74 - 102
Target Start/End: Original strand, 13617079 - 13617107
Alignment:
| Q |
74 |
tttttatgtaaactctagtgttgagtttg |
102 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
13617079 |
tttttatgtaaactctagtgttgagtttg |
13617107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University