View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2662_low_62 (Length: 248)
Name: NF2662_low_62
Description: NF2662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2662_low_62 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 17 - 233
Target Start/End: Complemental strand, 25683684 - 25683455
Alignment:
| Q |
17 |
gagaaagtctttaaattcgaagagagcttctagaagtacttacatattaatcactaacaggg--------------ccgttgaccctgttgaccgcggaa |
102 |
Q |
| |
|
||||||||||||||| ||||||||| |||| ||||||||||||||||||||||||||| || || ||||||||||||||||||||| |
|
|
| T |
25683684 |
gagaaagtctttaaactcgaagagaacttcc-gaagtacttacatattaatcactaacaaggttaacaccgacattccattgaccctgttgaccgcggaa |
25683586 |
T |
 |
| Q |
103 |
tttgaattcatatccttgttagatatgagttgaatcttcaccaaattagattgattgttatttattttggaaagaaattgcatcatggttcatgcactca |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25683585 |
tttgaattcatatccttgttagatatgagttgaatcttcaccaacttagattgattgttatttattttggaaagaaattgcatcatggttcatgcactca |
25683486 |
T |
 |
| Q |
203 |
cgtacgcaagacatggatttgtgtcaattat |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
25683485 |
cgtacgcaagacatggatttgtgtcaattat |
25683455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University