View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2662_low_63 (Length: 245)
Name: NF2662_low_63
Description: NF2662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2662_low_63 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 91 - 230
Target Start/End: Complemental strand, 2142909 - 2142771
Alignment:
| Q |
91 |
ctcaactttgcttttatcaaatttaataggtaaacattgatttattcacaaggtcgtggattcaattaggatatctatgatgtatgaggtgtaagtatac |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| ||| |||||||||| ||||| |
|
|
| T |
2142909 |
ctcaactttgcttttatcaaatttaataggtaaacattgatttattcgcaaggtcgtggattcaattaggacatctat-atgggtgaggtgtaactatac |
2142811 |
T |
|
| Q |
191 |
ctctctaaaacatatattccatggaagatcttgtggggat |
230 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
2142810 |
ctcactaaaacatatattccatggaagatcttgtggggat |
2142771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University