View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2662_low_67 (Length: 237)

Name: NF2662_low_67
Description: NF2662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2662_low_67
NF2662_low_67
[»] chr2 (1 HSPs)
chr2 (1-220)||(154675-154894)


Alignment Details
Target: chr2 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 154675 - 154894
Alignment:
1 caatgatctcagctctctatttttcactaccaacgacgatgccatccgcagcctattcaatgatggctccgcctctgctaacaccggatttcagctatca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
154675 caatgatctcagctctctatttttcactaccaacgacgatgccatccgcagcctattcaatgatggctccgcctctgctaacaccggatttcagctatca 154774  T
101 agtctcataattttcttcgtggcgatatacttgcttggaattgtgacatacggtgttgccattccctctggactcttcattcccgtcatacttgctggag 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
154775 agtctcataattttcttcgtggcgatatacttgcttggaattgtgacatacggtgttgccattccctctggactcttcattcccgtcatacttgctggag 154874  T
201 cttcttacgggcgtcttata 220  Q
    ||||||||||||||||||||    
154875 cttcttacgggcgtcttata 154894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University