View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2662_low_69 (Length: 237)

Name: NF2662_low_69
Description: NF2662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2662_low_69
NF2662_low_69
[»] chr5 (1 HSPs)
chr5 (1-51)||(11444779-11444829)


Alignment Details
Target: chr5 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 11444779 - 11444829
Alignment:
1 tgataatgatgatacctattaaaaatggacttcaaattttaatagtagctt 51  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
11444779 tgataatgatgatacctattaaaaatggacttcaaattttaatagtagctt 11444829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University