View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2662_low_73 (Length: 227)

Name: NF2662_low_73
Description: NF2662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2662_low_73
NF2662_low_73
[»] chr7 (1 HSPs)
chr7 (16-215)||(14727347-14727546)
[»] chr5 (1 HSPs)
chr5 (18-208)||(17595933-17596123)


Alignment Details
Target: chr7 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 16 - 215
Target Start/End: Complemental strand, 14727546 - 14727347
Alignment:
16 aaaggaaagagattctatagagaaatacgggaaagagattttgtagagaggaatctgggaagaggaagcttttctgtattgttcttcgtgctggtggaaa 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14727546 aaaggaaagagattctatagagaaatacgggaaagagattttgtagagaggaatctgggaagaggaagcttttctgtattgttcttcgtgctggtggaaa 14727447  T
116 gatattggaggggtagatatgatggcaagggagcactggtttcactagattttggttagatgtgtggacaggtttggttccgttcaccgagaagaagggt 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14727446 gatattggaggggtagatatgatggcaagggagcactggtttcactagattttggttagatgtgtggacaggtttggttccgttcaccgagaagaagggt 14727347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 18 - 208
Target Start/End: Original strand, 17595933 - 17596123
Alignment:
18 aggaaagagattctatagagaaatacgggaaagagattttgtagagaggaatctgggaagaggaagcttttctgtattgttcttcgtgctggtggaaaga 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
17595933 aggaaagagattctatagagaaatacgggaaagagattttgtagagaggaatctggggagaggaagcttttctgtattgttcttcgtgctggtggaaaga 17596032  T
118 tattggaggggtagatatgatggcaagggagcactggtttcactagattttggttagatgtgtggacaggtttggttccgttcaccgagaa 208  Q
    |||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||| | ||||||    
17596033 tattcgaggggtagatatgatggcaagggagcacttgtttcactagattttggttagatgtgtggacaggtttggttctgttaagcgagaa 17596123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University