View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2662_low_76 (Length: 218)
Name: NF2662_low_76
Description: NF2662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2662_low_76 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 21 - 192
Target Start/End: Original strand, 35228507 - 35228678
Alignment:
| Q |
21 |
cattgcatccatcagttgtattagttttcacacaatccactagctcttgctcagagagtgatactaatcttcctgtggttatttgatgaataccttctat |
120 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35228507 |
cattgcatccatcagttgtattagttttgacacaatccactagctcttgctcagagagtgatactaatcttcctgtggttatttgatgaataccttctat |
35228606 |
T |
|
| Q |
121 |
tgcagccacaattgcaaatgcccaacaactacctataaacaagaatcaacatcatcttaattagcataattt |
192 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35228607 |
tgcagccacagttgcaaatgcccaacaactacctataaacaagaatcaacatcatcttaattagcataattt |
35228678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 92 - 157
Target Start/End: Original strand, 31176914 - 31176979
Alignment:
| Q |
92 |
cctgtggttatttgatgaataccttctattgcagccacaattgcaaatgcccaacaactacctata |
157 |
Q |
| |
|
||||| |||||||| || ||||| ||||| | ||||||| ||| |||||||||||||||||||||| |
|
|
| T |
31176914 |
cctgttgttatttggtggataccctctatggaagccacagttgaaaatgcccaacaactacctata |
31176979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 96 - 149
Target Start/End: Complemental strand, 29746586 - 29746533
Alignment:
| Q |
96 |
tggttatttgatgaataccttctattgcagccacaattgcaaatgcccaacaac |
149 |
Q |
| |
|
|||||||||| || |||||||||||||||||||| | | |||||||||||||| |
|
|
| T |
29746586 |
tggttatttgttggataccttctattgcagccaccgtagaaaatgcccaacaac |
29746533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University