View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2663_high_23 (Length: 260)
Name: NF2663_high_23
Description: NF2663
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2663_high_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 255
Target Start/End: Complemental strand, 7217238 - 7216984
Alignment:
| Q |
1 |
ttgttgtagctcactaaccgaa-tttgtttggnnnnnnnnnagttttgctatatatgctaatagtgactgaatctctctattctcttgattttccagata |
99 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7217238 |
ttgttgtagctcactaaccgaaatttgtttgggttttttt-agttttgctatatatgctaatagtgactgaatctctctattctcttgattttccagata |
7217140 |
T |
 |
| Q |
100 |
gaaatcaatacccaagattgttgtttgttcaaaggtatacatagagaaagtgttgttttttcaaaggtacatagagagagatagaaaatgttaggttcaa |
199 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7217139 |
gaaatcaatacacaagattgttgtttgttcaaaggtatacatagagaaagtgttgttttttcaaaggtacatagagagagatagaaaatgttaggttcaa |
7217040 |
T |
 |
| Q |
200 |
agaaatctcctttgaaagatgctaaacccaggtctaagcataatccctttgcttct |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7217039 |
agaaatctcctttgaaagatgctaaacccaggtctaagcataatccctttgattct |
7216984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University