View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2663_low_16 (Length: 351)
Name: NF2663_low_16
Description: NF2663
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2663_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-115; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 53 - 336
Target Start/End: Complemental strand, 37776108 - 37775845
Alignment:
| Q |
53 |
tttcctttaaggggaacaagtgcagccacgggtgaggtatgcaaatcaagtagtttgctatccataaacattctccatgaatccgtttctctgtcgtata |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37776108 |
tttcctttaaggggaacaagtgcagccacgggtgaggtatgcaaatcaagtagtttgctatccataaacattctccatgaatccgtttctctgtc----- |
37776014 |
T |
|
| Q |
153 |
cagtgagcttcaatctgtcccgagaatcaagtgcatatagttgcctattcagtgaaatacaaagcttattactcaaacccgttaccattccatcagtaac |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37776013 |
---------------tgtcccgagaatcaagtgcatatagttgcctattcagtgaaatacaaagcttattactcaaacccgttaccattccatcagtaac |
37775929 |
T |
|
| Q |
253 |
agggctccaagtatttgtttccggagaatatgcttcacatacgatattgtaattggacccaagtccattcaaaaaccatgttcc |
336 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37775928 |
agggcttcaagtatttgtttctggagaatatgcttcacatacgatattgtaattggacccaagtccattcaaaaaccatgttcc |
37775845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 20 - 56
Target Start/End: Complemental strand, 37776161 - 37776125
Alignment:
| Q |
20 |
gacttgaaacatccactagactgatgctcatattttc |
56 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37776161 |
gacttgaaacatctactagactgatgctcatattttc |
37776125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 180 - 275
Target Start/End: Complemental strand, 37783164 - 37783069
Alignment:
| Q |
180 |
caagtgcatatagttgcctattcagtgaaatacaaagcttattactcaaacccgttaccattccatcagtaacagggctccaagtatttgtttccg |
275 |
Q |
| |
|
|||||||||| || || | ||||||||||||| ||||||||| || | |||| ||||||||||| | |||| |||||| | ||||||||||||| |
|
|
| T |
37783164 |
caagtgcatagagatgtccattcagtgaaatataaagcttatcacgccaaccatttaccattccactactaaccgggctctatgtatttgtttccg |
37783069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University