View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2663_low_26 (Length: 267)
Name: NF2663_low_26
Description: NF2663
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2663_low_26 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 180; Significance: 3e-97; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 15 - 202
Target Start/End: Complemental strand, 24862623 - 24862436
Alignment:
| Q |
15 |
aagctcaaccaagtccaattaaattttaaacttactagcctagctaactaattccatggtttaactgatcattacactattacaggggacttttgattca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
24862623 |
aagctcaaccaagtccaattaaattttaaacttactagcctagctaactaattccatggtttaactgatcattacactattacaagggacttttgattca |
24862524 |
T |
|
| Q |
115 |
ttgtttaaaaggtttgatgattgatccatggttcttgttgtgtctcagattacctttaagttctgtttggatcaaaaggaggttgcaa |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24862523 |
ttgtttaaaaggtttgatgattgatccatggttcttgttgagtctcagattacctttaagttctgtttggatcaaaaggaggttgcaa |
24862436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 227 - 267
Target Start/End: Original strand, 43555232 - 43555272
Alignment:
| Q |
227 |
gtgtagtcaccttgtgaatatccacaagagatcgatgtttc |
267 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
43555232 |
gtgtagtcaccttgtgtatatccacaagagatcgatatttc |
43555272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University