View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2663_low_35 (Length: 223)
Name: NF2663_low_35
Description: NF2663
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2663_low_35 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 9683407 - 9683202
Alignment:
| Q |
1 |
attggcatggacatgtttcagtattaatctttatactttgaaaatcttttgaggaagtttggagtaaaatactgcgctgcaaggcatatcatcttcaaac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||| |||||||||| |||||| |
|
|
| T |
9683407 |
attggcatggacatgtttcagtattaatctttataatttgaaaatcttttgaggaagtttggagtaaaatactgcgttgcaaagcatatcatcctcaaac |
9683308 |
T |
 |
| Q |
101 |
tagtgagtaagtggaggtctcaaatagagaaatcaaaagcattttggagaaaaccgtttctatgtcaagaaaagattgggatatgaagcttgacgatgca |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9683307 |
tagtgggtaagtggaggtctcaaatagagaaatcaaaagcattttggagaaaaccgtttctatgtcaagaaaagattgggatatgaagcttgacgatgca |
9683208 |
T |
 |
| Q |
201 |
ttttgg |
206 |
Q |
| |
|
||||| |
|
|
| T |
9683207 |
ctttgg |
9683202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University