View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2663_low_35 (Length: 223)

Name: NF2663_low_35
Description: NF2663
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2663_low_35
NF2663_low_35
[»] chr8 (1 HSPs)
chr8 (1-206)||(9683202-9683407)


Alignment Details
Target: chr8 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 9683407 - 9683202
Alignment:
1 attggcatggacatgtttcagtattaatctttatactttgaaaatcttttgaggaagtttggagtaaaatactgcgctgcaaggcatatcatcttcaaac 100  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||| |||||||||| ||||||    
9683407 attggcatggacatgtttcagtattaatctttataatttgaaaatcttttgaggaagtttggagtaaaatactgcgttgcaaagcatatcatcctcaaac 9683308  T
101 tagtgagtaagtggaggtctcaaatagagaaatcaaaagcattttggagaaaaccgtttctatgtcaagaaaagattgggatatgaagcttgacgatgca 200  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9683307 tagtgggtaagtggaggtctcaaatagagaaatcaaaagcattttggagaaaaccgtttctatgtcaagaaaagattgggatatgaagcttgacgatgca 9683208  T
201 ttttgg 206  Q
     |||||    
9683207 ctttgg 9683202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University