View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2664-Insertion-8 (Length: 211)
Name: NF2664-Insertion-8
Description: NF2664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2664-Insertion-8 |
 | |
|
| [»] chr3 (3 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 8 - 211
Target Start/End: Complemental strand, 38609322 - 38609119
Alignment:
| Q |
8 |
tttattgcaaatataagttctatgatatctctctaccgtctctttgtaaagcttgtttgcattgtgtttattgcaaatataagttaatttcttcaaaatt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38609322 |
tttattgcaaatataagttctatgatatctctctatcgtctctttgtaaagcttgtttgcattgtgtttattgcaaatataagttaatttcttcaaaatt |
38609223 |
T |
|
| Q |
108 |
tgtatttaaacaacatgtttcgaaggaataaaatgatgttaggttattgtgtcgtcagtttatcaagttatatgaggcacattgctctttgtttgtgtgt |
207 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38609222 |
tgtatttaaacaacatgttccgaaggaataaaatgatgttaggttattgtgtcgtcagtttatcaagttatatgagtcacattgctctttgtttgtgtgt |
38609123 |
T |
|
| Q |
208 |
cata |
211 |
Q |
| |
|
|||| |
|
|
| T |
38609122 |
cata |
38609119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 27 - 92
Target Start/End: Complemental strand, 38609369 - 38609304
Alignment:
| Q |
27 |
ctatgatatctctctaccgtctctttgtaaagcttgtttgcattgtgtttattgcaaatataagtt |
92 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38609369 |
ctatgatatctctctatcgtctctttgtaaagcttgtttgcattgtgtttattgcaaatataagtt |
38609304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 27 - 178
Target Start/End: Complemental strand, 38604267 - 38604116
Alignment:
| Q |
27 |
ctatgatatctctctaccgtctctttgtaaagcttgtttgcattgtgtttattgcaaatataagttaatttcttcaaaatttgtatttaaacaacatgtt |
126 |
Q |
| |
|
||||||| |||||||| | ||||| ||| || |||||||||||| |||| |||||| |||||| ||||||||||||||| | ||| ||| |||||||||| |
|
|
| T |
38604267 |
ctatgatgtctctctatcctctctctgtgaaacttgtttgcattttgttaattgcagatataatttaatttcttcaaaactagtaattagacaacatgtt |
38604168 |
T |
|
| Q |
127 |
tcgaaggaataaaatgatgttaggttattgtgtcgtcagtttatcaagttat |
178 |
Q |
| |
|
| ||| |||||||||| |||||| ||||| | |||| ||||||| ||||| |
|
|
| T |
38604167 |
ttagagggataaaatgatcttaggtcattgtattgtcaatttatcatgttat |
38604116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University