View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2664_high_15 (Length: 246)
Name: NF2664_high_15
Description: NF2664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2664_high_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 109; Significance: 6e-55; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 121 - 229
Target Start/End: Complemental strand, 40675708 - 40675600
Alignment:
| Q |
121 |
gttgctcttggggaaatgtttagaatgctggatctcaagggttcaacccaggcttgattgttctcctggttattggtgggttgctgttgacatttctcat |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40675708 |
gttgctcttggggaaatgtttagaatgctggatctcaagggttcaacccaggcttgattgttctcctggttattggtgggttgctgttgacatttctcat |
40675609 |
T |
 |
| Q |
221 |
tggaaatta |
229 |
Q |
| |
|
||||||||| |
|
|
| T |
40675608 |
tggaaatta |
40675600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 121 - 230
Target Start/End: Complemental strand, 40662152 - 40662043
Alignment:
| Q |
121 |
gttgctcttggggaaatgtttagaatgctggatctcaagggttcaacccaggcttgattgttctcctggttattggtgggttgctgttgacatttctcat |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
40662152 |
gttgctcttggggaaatgtttagaatgctggatctcaagggttcaacccagacttgattgttctcctcgttattggtgggttgctgttgacatttctcat |
40662053 |
T |
 |
| Q |
221 |
tggaaattat |
230 |
Q |
| |
|
|||||||||| |
|
|
| T |
40662052 |
tggaaattat |
40662043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 131 - 230
Target Start/End: Complemental strand, 40656866 - 40656767
Alignment:
| Q |
131 |
gggaaatgtttagaatgctggatctcaagggttcaacccaggcttgattgttctcctggttattggtgggttgctgttgacatttctcattggaaattat |
230 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||||||||||||| | ||||||||||||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
40656866 |
gggaaatatttagaaagctggatctcaagggttcaacccaggcttagtagttctcctggttattggtgggctgctgttgacattcctcattggaaattat |
40656767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University