View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2664_high_19 (Length: 220)
Name: NF2664_high_19
Description: NF2664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2664_high_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 147; Significance: 1e-77; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 196
Target Start/End: Original strand, 19197468 - 19197663
Alignment:
| Q |
1 |
cgttcaagttcactctgcaannnnnnncggctttcctcagccttttctatctctccgtctgcaactagatttacatacttctccaaagatttcttccttc |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19197468 |
cgttcaagttcactctgcaatttttttcggctttcctcagccttggctatcgctccgtctgcaactagatttacatacttctccaaagatttcttccttc |
19197567 |
T |
 |
| Q |
101 |
ccctttcaagttctttctgcaatttagaagtttgcaattagtttttaaattaaagttcaacttttcatctcccactacattttttacccggcctct |
196 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
19197568 |
ccctttcaagttcactctgcaatttagaagtttgcaattagtttttaaattaaagttcaacttttcatctcccaccacattttttacccagcctct |
19197663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 28 - 81
Target Start/End: Original strand, 19201478 - 19201531
Alignment:
| Q |
28 |
cggctttcctcagccttttctatctctccgtctgcaactagatttacatacttc |
81 |
Q |
| |
|
||||||||||||||||| || || | ||||||||||||||||||||||||||| |
|
|
| T |
19201478 |
cggctttcctcagccttggctctcgcgccgtctgcaactagatttacatacttc |
19201531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 163 - 200
Target Start/End: Original strand, 19201618 - 19201655
Alignment:
| Q |
163 |
tttcatctcccactacattttttacccggcctctctag |
200 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
19201618 |
tttcatctcccactacattttatacccggcctttctag |
19201655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University