View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2664_low_19 (Length: 224)
Name: NF2664_low_19
Description: NF2664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2664_low_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 67 - 208
Target Start/End: Original strand, 2014054 - 2014200
Alignment:
| Q |
67 |
tctgcaacgtcttttttataattatcagatgaagttcaacacaatcgtaaacggtcattagtttcacttta-----ttacataataatttcccttctcca |
161 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2014054 |
tctgcaatgtcttttttataattatcagatgaagttcaacacagtcgtaaacggtcattagtttcactttaatttattacataataatttcccttctcca |
2014153 |
T |
 |
| Q |
162 |
atttttcgctttaaattattaggcaaataatatagagatttgctact |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2014154 |
atttttcgctttaaattattaggcaaataatatagagattttctact |
2014200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University