View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2665_low_2 (Length: 249)
Name: NF2665_low_2
Description: NF2665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2665_low_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 26 - 235
Target Start/End: Original strand, 51743416 - 51743623
Alignment:
| Q |
26 |
aaatatcatccgttattacaatctatttgtttagttgtgatgttatattatttagaattttgagtttgaacttgggtcaccacatctcttctctcatgta |
125 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
51743416 |
aaatatcatcctttattacaatctagttgtttagttgtgatgttatattatttagaattttgagtttgaactcgggtcaccacatctcttctctcatgta |
51743515 |
T |
 |
| Q |
126 |
tatctttatttgagtacgtgttggttaagaaactgatagcnnnnnnngagagaataaaatactcttaaatttaaaataacagacccctattcatatttgt |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
51743516 |
tatctttatttgagtacgtgttggttaagaaactgatagcaaaaaa--agagaataaaatactcttaaatttaaaataacaggtctctattcatatttgt |
51743613 |
T |
 |
| Q |
226 |
tcttctcttt |
235 |
Q |
| |
|
|||||||||| |
|
|
| T |
51743614 |
tcttctcttt |
51743623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University